Original article
Genetic susceptibility to Gilbert's syndrome in a Valencian population; efficacy of the fasting test
Susceptibilidad genética del síndrome de Gilbert en población valenciana; eficiencia del test de ayuno
Read
12
Timeswas read the article
6
Total PDF
6
Total HTML
Share statistics
array:23 [ "pii" => "S2254887416300820" "issn" => "22548874" "doi" => "10.1016/j.rceng.2016.10.004" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "1315" "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI)" "copyrightAnyo" => "2016" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Rev Clin Esp. 2017;217:1-6" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2 "PDF" => 2 ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S0014256516301552" "issn" => "00142565" "doi" => "10.1016/j.rce.2016.10.001" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "1315" "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI)" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Rev Clin Esp. 2017;217:1-6" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 79 "formatos" => array:2 [ "HTML" => 57 "PDF" => 22 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">ORIGINAL</span>" "titulo" => "Susceptibilidad genética del síndrome de Gilbert en población valenciana; eficiencia del test de ayuno" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "6" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Genetic susceptibility to Gilbert's syndrome in a valencian population; efficacy of the fasting test" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3239 "Ancho" => 2506 "Tamanyo" => 628392 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Imagen de la secuencia de la región del gen <span class="elsevierStyleItalic">UGT1A1</span> que contiene la variante analizada rs8175347 [A(TA)TAA] muestra: A) genotipo (TA)<span class="elsevierStyleInf">6/6</span>, B) genotipo (TA)<span class="elsevierStyleInf">6/7</span> y C) genotipo (TA)<span class="elsevierStyleInf">7/7</span>.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "A.K. Torres, N. Escartín, C. Monzó, C. Guzmán, I. Ferrer, C. González-Muñoz, P. Peña, V. Monzó, G. Marcaida, R. Rodríguez-López" "autores" => array:10 [ 0 => array:2 [ "nombre" => "A.K." "apellidos" => "Torres" ] 1 => array:2 [ "nombre" => "N." "apellidos" => "Escartín" ] 2 => array:2 [ "nombre" => "C." "apellidos" => "Monzó" ] 3 => array:2 [ "nombre" => "C." "apellidos" => "Guzmán" ] 4 => array:2 [ "nombre" => "I." "apellidos" => "Ferrer" ] 5 => array:2 [ "nombre" => "C." "apellidos" => "González-Muñoz" ] 6 => array:2 [ "nombre" => "P." "apellidos" => "Peña" ] 7 => array:2 [ "nombre" => "V." "apellidos" => "Monzó" ] 8 => array:2 [ "nombre" => "G." "apellidos" => "Marcaida" ] 9 => array:2 [ "nombre" => "R." "apellidos" => "Rodríguez-López" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2254887416300820" "doi" => "10.1016/j.rceng.2016.10.004" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2254887416300820?idApp=WRCEE" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0014256516301552?idApp=WRCEE" "url" => "/00142565/0000021700000001/v1_201701170139/S0014256516301552/v1_201701170139/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S225488741630073X" "issn" => "22548874" "doi" => "10.1016/j.rceng.2016.09.003" "estado" => "S300" "fechaPublicacion" => "2017-01-01" "aid" => "1313" "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI)" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Rev Clin Esp. 2017;217:7-14" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2 "PDF" => 2 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Clinical characteristics during diagnosis of a prospective cohort of patients with systemic lupus erythematosus treated in Spanish Departments of Internal Medicine: The RELES study" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "7" "paginaFinal" => "14" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Características clínicas al diagnóstico de una cohorte prospectiva de pacientes con lupus eritematoso sistémico atendidos en servicios de Medicina Interna españoles: estudio RELES" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "J. Canora, M. García, F. Mitjavila, G. Espinosa, S. Suárez, R. González-León, B. Sopeña, R. Boldova, A. Castro, G. Ruiz-Irastorza" "autores" => array:11 [ 0 => array:2 [ "nombre" => "J." "apellidos" => "Canora" ] 1 => array:2 [ "nombre" => "M." "apellidos" => "García" ] 2 => array:2 [ "nombre" => "F." "apellidos" => "Mitjavila" ] 3 => array:2 [ "nombre" => "G." "apellidos" => "Espinosa" ] 4 => array:2 [ "nombre" => "S." "apellidos" => "Suárez" ] 5 => array:2 [ "nombre" => "R." "apellidos" => "González-León" ] 6 => array:2 [ "nombre" => "B." "apellidos" => "Sopeña" ] 7 => array:2 [ "nombre" => "R." "apellidos" => "Boldova" ] 8 => array:2 [ "nombre" => "A." "apellidos" => "Castro" ] 9 => array:2 [ "nombre" => "G." "apellidos" => "Ruiz-Irastorza" ] 10 => array:1 [ "colaborador" => "On behalf of the researchers from the RELES-Group of Systemic Autoimmune Diseases (GEAS)" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0014256516301515" "doi" => "10.1016/j.rce.2016.09.006" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0014256516301515?idApp=WRCEE" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S225488741630073X?idApp=WRCEE" "url" => "/22548874/0000021700000001/v1_201701170152/S225488741630073X/v1_201701170152/en/main.assets" ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Genetic susceptibility to Gilbert's syndrome in a Valencian population; efficacy of the fasting test" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "1" "paginaFinal" => "6" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "A.K. Torres, N. Escartín, C. Monzó, C. Guzmán, I. Ferrer, C. González-Muñoz, P. Peña, V. Monzó, G. Marcaida, R. Rodríguez-López" "autores" => array:10 [ 0 => array:3 [ "nombre" => "A.K." "apellidos" => "Torres" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "N." "apellidos" => "Escartín" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "C." "apellidos" => "Monzó" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "C." "apellidos" => "Guzmán" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 4 => array:3 [ "nombre" => "I." "apellidos" => "Ferrer" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 5 => array:3 [ "nombre" => "C." "apellidos" => "González-Muñoz" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 6 => array:3 [ "nombre" => "P." "apellidos" => "Peña" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 7 => array:3 [ "nombre" => "V." "apellidos" => "Monzó" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 8 => array:3 [ "nombre" => "G." "apellidos" => "Marcaida" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 9 => array:4 [ "nombre" => "R." "apellidos" => "Rodríguez-López" "email" => array:1 [ 0 => "rodriguez_raqlop@gva.es" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Laboratorio de Genética Molecular, Servicio de Análisis Clínicos, Hospital General de Valencia, Valencia, Spain" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Servicio de Digestivo, Hospital General de Valencia, Valencia, Spain" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Laboratorio de Bioquímica, Servicio de Análisis Clínicos, Hospital General de Valencia, Valencia, Spain" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Susceptibilidad genética del síndrome de Gilbert en población valenciana; eficiencia del test de ayuno" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3239 "Ancho" => 2510 "Tamanyo" => 631863 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Image of the sequence of the <span class="elsevierStyleItalic">UGT1A1</span> gene region containing the analyzed variant rs8175347 [A(TA)TAA] showing the following: (A) genotype (TA)<span class="elsevierStyleInf">6/6</span>, (B) genotype (TA)<span class="elsevierStyleInf">6/7</span> and (C) genotype (TA)<span class="elsevierStyleInf">7/7</span>.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Background</span><p id="par0005" class="elsevierStylePara elsevierViewall">Bilirubin is the breakdown product of the hemo group of hemoglobin. The plasma concentration of the unconjugated fraction or indirect bilirubin (IB) is determined by the rate at which it passes into plasma at the time of its production and the rate of its uptake by the liver.<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">1</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Gilbert's syndrome (GS, Online Mendelian Inheritance in Man #143500), first described in 1901 by Augustine Gilbert and Pierre Lereboullet,<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">2</span></a> is a benign disorder of variable inheritance and incomplete penetrance. The condition is characterized by unconjugated or indirect hyperbilirubinemia in moderate concentrations (<3<span class="elsevierStyleHsp" style=""></span>mg/dL), normal hepatic function, lack of hemolysis and a normal hepatic histology.<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">1,3,4</span></a> Its prevalence in the general population varies between 4% and 16%,<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">5</span></a> with a male–female ratio of 4:1.<a class="elsevierStyleCrossRefs" href="#bib0100"><span class="elsevierStyleSup">3,4</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">The main causal genetic alteration in GS is a defect in the gene promotor region that encodes the uridine diphosphate glucuronyl transferase 1A1 enzyme (<span class="elsevierStyleItalic">UGT1A1</span> Online Mendelian Inheritance in Man <span class="elsevierStyleItalic">#191740</span>), located in chromosome 2q37. This enzyme is responsible for the conjugation of bilirubin with glucuronic acid, making it more water soluble and facilitating its excretion.<a class="elsevierStyleCrossRefs" href="#bib0095"><span class="elsevierStyleSup">2,5,6</span></a> The molecular basis that has been related to the biochemical elevation characteristic of patients with GS is the insertion of a dinucleotide plus thymine/adenine (TA additional) in the TATA box of the <span class="elsevierStyleItalic">UGT</span> gene promoter, which is known as allele UGT1A1*28 (rs8175347) and can decrease the enzymatic function of UGT by up to 30%. The genotype of a healthy individual includes alleles (TA)<span class="elsevierStyleInf">6/6</span> or [A(TA)6TAA]. A heterozygous individual has (TA)<span class="elsevierStyleInf">6/7</span>, and a homozygous individual carries the combination (TA)<span class="elsevierStyleInf">7/7</span> or [A(TA)7TAA].<a class="elsevierStyleCrossRefs" href="#bib0105"><span class="elsevierStyleSup">4,7</span></a> The documented frequency of these genotypes in the Spanish population coincides with that calculated for the European population, which varies between 38% and 47% for genotype (TA)<span class="elsevierStyleInf">6/6</span>, between 8.5% and 13.6% for (TA)<span class="elsevierStyleInf">7/7</span> and between 44.6% and 51% for (TA)<span class="elsevierStyleInf">6/7</span>.<a class="elsevierStyleCrossRefs" href="#bib0120"><span class="elsevierStyleSup">7–9</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Noteworthy differences have been reported in the frequency of alleles (TA)<span class="elsevierStyleInf">6</span> and (TA)<span class="elsevierStyleInf">7</span> in the general population of various regions of Spain. Variants (TA)<span class="elsevierStyleInf">5</span> and (TA)<span class="elsevierStyleInf">8</span>, which were uncommon in the study populations, have an unknown frequency in our community. The frequency of the deleterious allele (TA)<span class="elsevierStyleInf">7</span> has been calculated at 25%<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">10</span></a> in a control population of northwestern Spain, 30% in the center<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">11</span></a> and 35% in northeast regions of the country.<a class="elsevierStyleCrossRefs" href="#bib0120"><span class="elsevierStyleSup">7,12–15</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">Other causal variants for GS have also been identified in gene <span class="elsevierStyleItalic">UGT1A1</span>, such as variants UGT1A1*6, UGT1A1*27 and UGT1A1*28, which are highly prevalent mutations in Asian populations.<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">16</span></a></p><p id="par0030" class="elsevierStylePara elsevierViewall">Most patients with GS are diagnosed between the second and third decade of life and are generally asymptomatic. Unconjugated hyperbilirubinemia is frequently found in routine laboratory tests.<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">1</span></a> Due to the incomplete penetrance of GS, the clinical phenotype does not always manifest in patients with the genetic abnormalities. Environmental factors such as alcohol-induced hepatic bilirubin glucuronidation facilitate the reduction in serum bilirubin levels, thereby preventing the development of the pathological phenotype.<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">17</span></a> The main diagnostic criterion is the detection of increased total bilirubin (TB) at the expense of IB, with direct bilirubin (DB) in normal concentrations. Jaundice occurs intermittently and is mainly increased in prolonged fasting conditions, alcohol consumption, stress, fever, infections, dehydration, exercise and menstruation.<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">2</span></a></p><p id="par0035" class="elsevierStylePara elsevierViewall">Apart from the genetic tests, the fasting test is still considered diagnostic for GS. The variation in bilirubin after a diet of ≤400 calories is measured for 48<span class="elsevierStyleHsp" style=""></span>h and is considered positive when the IB increases by 100% over baseline. Other diagnostic tests, such as provocation with nicotinic acid or the stimulation test with rifampicin, are already in disuse.<a class="elsevierStyleCrossRefs" href="#bib0100"><span class="elsevierStyleSup">3,4</span></a></p><p id="par0040" class="elsevierStylePara elsevierViewall">The aim of this study was to establish, in a Valencian population, the distribution of allele UGT1A1*28 in a group of unselected individuals and a group with suspected GS. Although the technique of choice (due to its lower cost/efficiency) for analyzing variants (TA)<span class="elsevierStyleInf">6</span> and (TA)<span class="elsevierStyleInf">7</span> is genotyping using allelic discrimination probes, we employed the Sanger sequencing method because it helps detect the described allelic variants and (TA)<span class="elsevierStyleInf">5</span> and (TA)<span class="elsevierStyleInf">8</span>, whose prevalence is unknown in our community. We also studied the association of these allelic variants with the fasting test and diagnosis of GS.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Patients and methods</span><p id="par0045" class="elsevierStylePara elsevierViewall">The study included 144 patients previously diagnosed with GS according to the following clinical criteria: TB values ≥1.3<span class="elsevierStyleHsp" style=""></span>mg/dL at the expense of IB (normal IB values, 0.2–0.9<span class="elsevierStyleHsp" style=""></span>mg/dL) and with DB within normal limits (DB, 0.1–0.4<span class="elsevierStyleHsp" style=""></span>mg/dL), maintained over extended periods of time and classically started in adolescence. For the diagnosis of GS, hemolysis (high levels of lactate dehydrogenase or schistocytes), blood transfusion, hematoma reabsorption and ineffective erythropoiesis should be ruled out. The patient's case history, clinical examination and laboratory tests should rule out drops in hemoglobin levels (<12<span class="elsevierStyleHsp" style=""></span>g/dL), increased reticulocyte counts, reduction or absence of haptoglobin and increased lactate dehydrogenase levels. Acquired hepatobiliary diseases should also be ruled out with biochemical tests showing normal hepatic function (alkaline phosphatase, transaminases). Being a member of a family in which cases of hyperbilirubinemia or GS have been reported is a high-risk criterion for the diagnosis. In our series, the study of closely related individuals was ruled out.</p><p id="par0050" class="elsevierStylePara elsevierViewall">A fasting test had been previously performed in 38 of the 144 patients due to suspected GS. The possible test results were classified as follows: “compatible”, when the increase in IB was ≥75% over baseline; “inconclusive”, when the increase in IB was <74% over baseline; and “incompatible”, when the increase in IB over baseline was <50% or there was none.</p><p id="par0055" class="elsevierStylePara elsevierViewall">We established the frequency of the causal variant in our control population based on the results of 150 individuals referred to the Department of Oncology. These individuals were analyzed because this variant rs8175347 predicts the susceptibility of experiencing drug toxicity with irinotecan. To compare the genetic profile, we considered this group of individuals as representative of the Valencian control population, given that none of them were suspected of GS.</p><p id="par0060" class="elsevierStylePara elsevierViewall">The biochemical measurements were performed using standard photometric methods using an AU5400 automated chemistry immunoanalyzer (Beckman Coulter). After obtaining the patients’ informed consent, we extracted a blood sample from each individual using ethylenediaminetetraacetic acid anticoagulant and extracted the deoxyribonucleic acid using the QIAcube semiautomated extractor (QIAGEN). The fragment containing the promotor region of the TATA box of gene <span class="elsevierStyleItalic">UGT1A1</span> was amplified using a polymerase chain reaction, using the sense primer 5′AATGGATCCTGAGGTTCTGG3′ and the antisense primer 5′ATTTCATGTCCCCTCTGCTG3′. We then conducted Sanger sequencing of the amplified fragment using the 3130 sequencer from Applied Biosystems. For the results analysis, we employed the following specific software: Sequencing analysis (Applied Biosystems) and SeqScape V3.0 (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">We applied the Hardy–Weinberg law, comparing the allelic and genotypic frequencies in both population groups with the SNPStats software and calculated the odds ratio (OR) using the chi-squared test. We confirmed the descriptive statistics and association studies of the allele analyzed in <span class="elsevierStyleItalic">UGT1A1</span> with phenotypic variables, using the analysis of variance and the Bonferroni multiple comparison test.</p></span></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Results</span><p id="par0070" class="elsevierStylePara elsevierViewall">We analyzed 294 individuals (144 patients and 150 controls representative of the general Valencian population) with a mean age of 43.6 years (range, 3–86 years); 68% of the individuals were men. The frequency of allele UGT1A1*28, (TA)<span class="elsevierStyleInf">7</span> in the general Valencian population was 32%. The prevalence of the allele reached 87.6% among the patients referred for suspected GS, whose mean TB values were 2.41<span class="elsevierStyleHsp" style=""></span>mg/dL (1.31–14.22<span class="elsevierStyleHsp" style=""></span>mg/dL) at the expense of IB readings of 2.61<span class="elsevierStyleHsp" style=""></span>mg/dL (0.96–13.54<span class="elsevierStyleHsp" style=""></span>mg/dL).</p><p id="par0075" class="elsevierStylePara elsevierViewall">We did not detect alleles (TA)<span class="elsevierStyleInf">5</span> or (TA)<span class="elsevierStyleInf">8</span> in the series or other genetic variants in the sequenced fragment of 200 base pairs flanking the TATA box of the promotor. The distribution of the allele in the control population was adjusted to the expected according to the Hardy–Weinberg law (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>.01), whose imbalance in the patient group showed differences with a statistical significance parallel to the risk attributed to the genotypes of hyperbilirubinemia susceptibility (OR, 2.58 [1.05–6.34] for genotype (TA)<span class="elsevierStyleInf">6/7</span> and 61.60 [25.29–150.07] for genotype (TA)<span class="elsevierStyleInf">7/7</span>).</p><p id="par0080" class="elsevierStylePara elsevierViewall">The mean TB and IB values among the homozygous individuals (TA)<span class="elsevierStyleInf">7/7</span> were 2.36<span class="elsevierStyleHsp" style=""></span>mg/dL (1.31–14.22<span class="elsevierStyleHsp" style=""></span>mg/dL) and 2.51<span class="elsevierStyleHsp" style=""></span>mg/dL (0.99–13.54<span class="elsevierStyleHsp" style=""></span>mg/dL), respectively. Among the heterozygous carriers, the mean TB and IB values were 2.33<span class="elsevierStyleHsp" style=""></span>mg/dL (1.48–7.6<span class="elsevierStyleHsp" style=""></span>mg/dL) and 2.99<span class="elsevierStyleHsp" style=""></span>mg/dL (1.21–7.25<span class="elsevierStyleHsp" style=""></span>mg/dL), respectively.</p><p id="par0085" class="elsevierStylePara elsevierViewall">Among the patients with genotype (TA)<span class="elsevierStyleInf">6/6</span>, we found TB concentrations of 2.13<span class="elsevierStyleHsp" style=""></span>mg/dL (1.18–3.47<span class="elsevierStyleHsp" style=""></span>mg/dL), at the expense of IB concentrations of 2.04<span class="elsevierStyleHsp" style=""></span>mg/dL (0.96–2.93<span class="elsevierStyleHsp" style=""></span>mg/dL). Two individuals with genotype (TA)<span class="elsevierStyleInf">6/6</span> reached TB values of 5.31 and 7.96<span class="elsevierStyleHsp" style=""></span>mg/dL and IB values of 4.78 and 7.18<span class="elsevierStyleHsp" style=""></span>mg/dL, respectively, and were therefore clinically reassessed.</p><p id="par0090" class="elsevierStylePara elsevierViewall">The results of the fasting test in the group of 38 patients who underwent the test showed that 57.9% of the participants were “compatible with GS”, 21.05% were “incompatible” and another 21.05% were “inconclusive”. The genotypic frequencies of the <span class="elsevierStyleItalic">UGT1A1</span> polymorphism were 84.21% (32 patients) for (TA)<span class="elsevierStyleInf">7/7</span>, 2.63% (1 patient) for (TA)<span class="elsevierStyleInf">6/7</span> and 13.16% (5 patients) for (TA)<span class="elsevierStyleInf">6/6</span>. The mean baseline TB and IB values in these 38 patients were 2.33<span class="elsevierStyleHsp" style=""></span>mg/dL (0.82–7.96<span class="elsevierStyleHsp" style=""></span>mg/dL) and 2.02<span class="elsevierStyleHsp" style=""></span>mg/dL (0.7–7.18<span class="elsevierStyleHsp" style=""></span>mg/dL), respectively. After performing the fasting test, the TB and IB concentrations increased to 3.64<span class="elsevierStyleHsp" style=""></span>mg/dL (1.18–7.21<span class="elsevierStyleHsp" style=""></span>mg/dL) and 3.19<span class="elsevierStyleHsp" style=""></span>mg/dL (0.96–6.71<span class="elsevierStyleHsp" style=""></span>mg/dL), respectively.</p><p id="par0095" class="elsevierStylePara elsevierViewall">Six of the 38 patients in whom the baseline TB level was not changed by the fasting were homozygous for allele UGT1A1*28, which is considered responsible for GS. Therefore, when comparing the results of the fasting test with each patient's genotype, we can infer a false negative rate for the fasting test of 15.79%.</p><p id="par0100" class="elsevierStylePara elsevierViewall">Two of these 38 patients (5.26%) showed increased TB levels after the fasting test from 2.05–2.82<span class="elsevierStyleHsp" style=""></span>mg/dL to 4.61–5.01<span class="elsevierStyleHsp" style=""></span>mg/dL and increased IB levels from 1.82–2.76<span class="elsevierStyleHsp" style=""></span>mg/dL to 4.26–4.91<span class="elsevierStyleHsp" style=""></span>mg/dL. Through this test, these patients received a diagnosis compatible with GS but were not carriers of the genetic variant considered pathogenic.</p><p id="par0105" class="elsevierStylePara elsevierViewall">Another 6 of the 38 patients (15.79%) were reported as having an “inconclusive” fasting test. In 2 cases, this result was attributable to improper fasting. The resulting genotypes were 1 (TA)<span class="elsevierStyleInf">6/6</span> carrier and 5 (TA)<span class="elsevierStyleInf">7/7</span> carrier patients. None of these patients were diagnosed with GS after the fasting test was performed.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Discussion</span><p id="par0110" class="elsevierStylePara elsevierViewall">The growing application of the analysis of allele rs8175347 (UGT1A1*28, (TA)<span class="elsevierStyleInf">7</span>) in the pharmacogenetics setting helped us establish its prevalence in our general population, which was slightly lower than the prevalence reported in Catalan or Madrid populations and somewhat higher than that found in Galician populations (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). Until now, the prevalence of this allele in the Valencian population was unknown.</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0115" class="elsevierStylePara elsevierViewall">The 144 genetically analyzed patients were mostly men, with a mean age of 44 years. The pathogenic genotypes (TA)<span class="elsevierStyleInf">6/7</span> and (TA)<span class="elsevierStyleInf">7/7</span>, mutated heterozygotes and homozygotes, respectively, were distributed among the patients with much greater frequency than among the control population. The comparison of these genotypic frequencies revealed the risk attributable to genotypes (TA)<span class="elsevierStyleInf">6/7</span> and (TA)<span class="elsevierStyleInf">7/7</span> for presenting the clinical criteria characteristic of GS. The calculated values for OR were 2.58 and 61.60 for genotypes (TA)<span class="elsevierStyleInf">6/7</span> and (TA)<span class="elsevierStyleInf">7/7</span>, respectively.</p><p id="par0120" class="elsevierStylePara elsevierViewall">No other genetic abnormality was identified in the analyzed region of the <span class="elsevierStyleItalic">UGT1A1</span> gene promotor, leaving the rs8175347 mutation as the main causal agent of GS in our population.</p><p id="par0125" class="elsevierStylePara elsevierViewall">The TB and IB concentrations reached by the (TA)<span class="elsevierStyleInf">7/7</span> individuals were very similar to those detected in patients with genotype (TA)<span class="elsevierStyleInf">6/7</span>. This fact shows the codominant effect of variant UGT1A1*28, (TA)<span class="elsevierStyleInf">7</span>, and the deleterious capacity of the genotype in heterozygosity, quantifiable in terms of continuous and correlatable quantitative biochemical parameters. However, the mean values were higher in 2 patients with genotype (TA)<span class="elsevierStyleInf">6/6</span>, with TB values of 5.3<span class="elsevierStyleHsp" style=""></span>mg/dL and 7.96<span class="elsevierStyleHsp" style=""></span>mg/dL and IB values of 4.78<span class="elsevierStyleHsp" style=""></span>mg/dL and 7.18<span class="elsevierStyleHsp" style=""></span>mg/dL, respectively. After a comprehensive clinical assessment, a complete molecular study of gene <span class="elsevierStyleItalic">UGT1A1</span> was indicated for the first patient due to suspected mild or type 2 Crigler-Najjar disease. The second patient was a candidate for a genetic study of hereditary spherocytosis, confirming the dominant hereditary pattern of the hematological and biochemical traits (hyperbilirubinemia) in the patient's mother and 2 of the patient's children.</p><p id="par0130" class="elsevierStylePara elsevierViewall">In terms of the fasting test, there was a false negative rate of 15.79% among the patients with GS confirmed by the genetic study. Five percent of the patients received a positive report on the fasting test, but the sequencing of variant UGT1A1*28 showed that they had inherited the normal allele (TA)<span class="elsevierStyleInf">6</span> – genotype (TA)<span class="elsevierStyleInf">6/6</span> – from both progenitors. Their TB and IB concentrations remained especially high from an early age. For this type of patient, complete sequencing of gene <span class="elsevierStyleItalic">UGT1A1</span> is justified when faced with the possibility that the patient has inherited other changes in the gene capable of causing the biochemical disorder, even with more severity than variant UGT1A1*28.</p><p id="par0135" class="elsevierStylePara elsevierViewall">The fasting test is difficult to comply with, which in our series could have resulted in “inconclusive” results for up to 15.79% of the individuals. Additionally, the time established for fasting varies between 24 and 48<span class="elsevierStyleHsp" style=""></span>h, and the cutoff for TB and IB elevation for considering a positive result was also not established equally among the centers, all of which detracts from its usefulness compared with genetic analysis.</p><p id="par0140" class="elsevierStylePara elsevierViewall">Considering the results from this study, we have been able to determine the relationship between mutation rs8175347 and the development of GS. We can conclude that the high frequency of allele (TA)<span class="elsevierStyleInf">7</span> among individuals of the Valencian control population corresponds to the expected frequency, due to the high rate of GS in the Spanish population. The comparison among regions situated at the geographical ends of the country show a homogeneous distribution in terms of the frequency of allele (TA)<span class="elsevierStyleInf">7</span>. The comparison between the results of the fasting test and the genetic study of gene <span class="elsevierStyleItalic">UGT1A1</span> show the low reliability of the fasting test for diagnosing GS.</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Conflict of interest</span><p id="par0145" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflict of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:11 [ 0 => array:3 [ "identificador" => "xres790035" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Patients and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec788306" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres790034" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Pacientes y métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec788305" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Background" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Patients and methods" "secciones" => array:1 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Statistical analysis" ] ] ] 6 => array:2 [ "identificador" => "sec0020" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "sec0025" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0030" "titulo" => "Conflict of interest" ] 9 => array:2 [ "identificador" => "xack264448" "titulo" => "Acknowledgements" ] 10 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2016-06-24" "fechaAceptado" => "2016-10-02" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec788306" "palabras" => array:4 [ 0 => "Gilbert's syndrome" 1 => "Hyperbilirubinemia" 2 => "Fasting" 3 => "<span class="elsevierStyleItalic">UGT1A1</span>" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec788305" "palabras" => array:4 [ 0 => "Síndrome de Gilbert" 1 => "Hiperbilirrubinemia" 2 => "Ayuno" 3 => "<span class="elsevierStyleItalic">UGT1A1</span>" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Objective</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">To describe the population distribution of the UGT1A1*28 variant (genetic variant code rs8175347) located in the promotor of the <span class="elsevierStyleItalic">UGT</span> gene and correlate its genotypes with the results of the fasting test, as well as its relationship with the biochemical disorder of Gilbert's syndrome (GS) in a Valencian population.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Patients and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">We studied the prevalence of the genotypes (TA)<span class="elsevierStyleInf">6/6</span> (TA)<span class="elsevierStyleInf">6/7</span> and (TA)<span class="elsevierStyleInf">7/7</span> of the deleterious variant rs8175347 in 144 patients with hyperbilirubinemia, 38 of whom had previously undergone the fasting test to diagnose GS, and in 150 control patients. By analysing the genomic region of the TATA box of the <span class="elsevierStyleItalic">UGT1A1</span> gene promotor using Sanger sequencing, we established the correlation between the rs8175347 genotypes and the fasting test results and with the patients’ biochemical disorders.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The rate of heterozygosity of allele (TA)<span class="elsevierStyleInf">7</span> in the control population was 32% and increased to 87.59% among the patients with suspected GS. The rate of genotype TA<span class="elsevierStyleInf">7/7</span> was 81.94% among the patients with hyperbilirubinemia, compared with 11.33% in the control patients. The fasting test showed a 15.79% rate of false negatives and a 5.26% rate of false positives.</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The high frequency of allele (TA)<span class="elsevierStyleInf">7</span> among the Valencian control population, almost double the 5% reported for European control patients, confirms the high rate of GS reported in the Spanish population, without observing significant differences between the geographical ends of the country. The efficacy and reliability of the fasting test for the diagnosis of GS is questionable.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Patients and methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Objetivo</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Describir la distribución poblacional de la variante UGT1A1*28 (código de variante genética rs8175347) localizada en el promotor del gen <span class="elsevierStyleItalic">UGT1A1</span> y correlacionar sus genotipos con los resultados de la prueba de ayuno, así como su relación con la alteración bioquímica propia del síndrome de Gilbert (SG) en población valenciana.</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Pacientes y métodos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Estudiamos la prevalencia de los genotipos (TA)<span class="elsevierStyleInf">6/6</span> (TA)<span class="elsevierStyleInf">6/7</span> y (TA)<span class="elsevierStyleInf">7/7</span> de la variante deletérea rs8175347, en 144 pacientes con hiperbilirrubinemia, de los cuales 38 habían sido sometidos previamente a la prueba del ayuno para realizar el diagnóstico de SG, y en 150 individuos control. Analizando la región genómica de la caja TATA del promotor del gen <span class="elsevierStyleItalic">UGT1A1</span> mediante secuenciación Sanger, se estableció la correlación de los genotipos rs8175347 con los resultados del test del ayuno y con las alteraciones bioquímicas de los pacientes.</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">La frecuencia de heterocigosidad del alelo (TA)<span class="elsevierStyleInf">7</span> en población control fue 32% y ascendió al 87,59% entre pacientes con sospecha de SG. La frecuencia del genotipo TA<span class="elsevierStyleInf">7/7</span> fue del 81,94% entre los pacientes, frente a un 11,33% en controles. La prueba de ayuno mostró un 15,79% de falsos negativos y un 5,26% de falsos positivos.</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusiones</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">La elevada frecuencia del alelo (TA)<span class="elsevierStyleInf">7</span> entre individuos de población control valenciana, casi el doble del 5% descrito en individuos control europeos, corrobora la elevada frecuencia del SG descrita en población española, sin observarse diferencias significativas entre extremos geográficos del país. La eficacia y fiabilidad de la prueba del ayuno para el diagnóstico del SG es cuestionable.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Pacientes y métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusiones" ] ] ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Please cite this article as: Torres AK, Escartín N, Monzó C, Guzmán C, Ferrer I, González-Muñoz C, et al. Susceptibilidad genética del síndrome de Gilbert en población valenciana; eficiencia del test de ayuno. Rev Clin Esp. 2017;217:1–6.</p>" ] ] "multimedia" => array:2 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3239 "Ancho" => 2510 "Tamanyo" => 631863 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Image of the sequence of the <span class="elsevierStyleItalic">UGT1A1</span> gene region containing the analyzed variant rs8175347 [A(TA)TAA] showing the following: (A) genotype (TA)<span class="elsevierStyleInf">6/6</span>, (B) genotype (TA)<span class="elsevierStyleInf">6/7</span> and (C) genotype (TA)<span class="elsevierStyleInf">7/7</span>.</p>" ] ] 1 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Population \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Prevalence of allele (TA)<span class="elsevierStyleInf">7</span> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Reference \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Santiago de Compostela \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">24.7% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Lamas, 2010 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Madrid \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">36% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Bernabeu, 2009 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Madrid \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">30% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Cabaleiro, 2013 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Barcelona \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">34.5% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Fernández, 2000 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Barcelona \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">33% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Font, 2003 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Barcelona \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">34.2% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Marcuello, 2004 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Barcelona \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">36% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Martínez Ballibrea, 2010 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Valencia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">32% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">This article \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1319688.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Prevalence of allele rs8175347 (TA)<span class="elsevierStyleInf">7</span> in populations from different geographical areas of Spain.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:17 [ 0 => array:3 [ "identificador" => "bib0090" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Síndrome de Gilbert" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.I. Vicente Diez" 1 => "F. Robles Agudo" 2 => "M. Beltrán de la Ascensión" 3 => "F. Sanz Segovia" 4 => "J.M. López Arrieta" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Esp Geriatr Gerontol" "fecha" => "2002" "volumen" => "37" "paginaInicial" => "316" "paginaFinal" => "318" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0095" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hereditary hyperbilirubinemias" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "N. Radlović" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Srp Arh Celok Lek" "fecha" => "2014" "volumen" => "142" "paginaInicial" => "257" "paginaFinal" => "260" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24839786" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0100" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Síndrome de Gilbert ¿qué es y cómo diagnosticarlo?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "G. Campuzano Maya" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Med Lab" "fecha" => "2006" "volumen" => "12" "paginaInicial" => "311" "paginaFinal" => "323" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0105" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Síndrome de Gilbert: estudio de 12 observaciones y revisión de la bibliografía médica" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y. Delgado Peña" 1 => "J. Fleta Zaragozano" 2 => "A. Lázaro Almarza" 3 => "M. Casanova Gracia" 4 => "A. Jiménez Vidal" 5 => "J. Olivares López" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Acta Pediatr Esp" "fecha" => "2007" "volumen" => "65" "paginaInicial" => "404" "paginaFinal" => "408" ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0110" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Presentación inusual de la enfermedad de Gilbert con altos niveles de bilirrubina no conjugada. Presentación de dos casos" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "E. Flores-Villalba" 1 => "C. Rodríguez-Montalvo" 2 => "F. Bosques-Padilla" 3 => "G. Arredondo-Saldaña" 4 => "T. Zertuche Maldonado" 5 => "L. Torre-Flores" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.17235/reed.2015.3719/2015" "Revista" => array:6 [ "tituloSerie" => "Rev Esp Enferm Dig" "fecha" => "2015" "volumen" => "108" "paginaInicial" => "228" "paginaFinal" => "230" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26181050" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0115" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Snapback primer henotyping of the Gilbert syndrome UGT1A1 (TA)n promoter polymorphism by high-resolution melting" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.S. Farrar" 1 => "R.A. Palais" 2 => "C.T. Wittwer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1373/clinchem.2011.166306" "Revista" => array:6 [ "tituloSerie" => "Clin Chem" "fecha" => "2011" "volumen" => "57" "paginaInicial" => "1303" "paginaFinal" => "1310" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21771946" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0120" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Distribución del genotipo A(TA)7TAA asociado al síndrome de Gilbert en la población española" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.M. Fernández Salazar" 1 => "A. Remacha Sevilla" 2 => "E. del Río Conde" 3 => "M. Baiget Bastús" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Med Clin (Barc)" "fecha" => "2000" "volumen" => "115" "paginaInicial" => "540" "paginaFinal" => "541" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0125" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "UGT1A1(TA)n promoter polymorphism – a new case of a (TA)8 allele in Caucasians" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "B. Ostanek" 1 => "D. Furlan" 2 => "T. Mavec" 3 => "J. Lukac-Bajalo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bcmd.2006.10.160" "Revista" => array:6 [ "tituloSerie" => "Blood Cells Mol Dis" "fecha" => "2007" "volumen" => "38" "paginaInicial" => "78" "paginaFinal" => "82" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17196409" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0130" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Extreme neonatal hyperbilirubinemia and a specific genotype: a population-based case–control study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.P. Petersen" 1 => "T.B. Henriksen" 2 => "M.V. Hollegaard" 3 => "P.K. Vandborg" 4 => "D.M. Hougaard" 5 => "O. Thorlacius-Ussing" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1542/peds.2014-0035" "Revista" => array:6 [ "tituloSerie" => "Pediatrics" "fecha" => "2014" "volumen" => "134" "paginaInicial" => "510" "paginaFinal" => "515" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25092941" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0135" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The value of genetic polymorphisms to predict toxicity in metastatic colorectal patients with irinotecan-based regimens" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.J. Lamas" 1 => "G. Duran" 2 => "E. Balboa" 3 => "B. Bernardez" 4 => "S. Candamio" 5 => "Y. Vidal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00280-012-1866-2" "Revista" => array:6 [ "tituloSerie" => "Cancer Chemother Pharmacol" "fecha" => "2012" "volumen" => "69" "paginaInicial" => "1591" "paginaFinal" => "1599" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22535333" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0140" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Polymorphisms influencing olanzapine metabolism and adverse effects in healthy subjects" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "T. Cabaleiro" 1 => "R. López-Rodríguez" 2 => "D. Ochoa" 3 => "M. Román" 4 => "J. Novalbos" 5 => "F. Abad-Santos" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hup.2308" "Revista" => array:6 [ "tituloSerie" => "Hum Psychopharmacol" "fecha" => "2013" "volumen" => "28" "paginaInicial" => "205" "paginaFinal" => "214" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23559402" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0145" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "UGT1A1 gene variations and irinotecan treatment in patients with metastatic colorectal cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "E. Marcuello" 1 => "A. Altés" 2 => "A. Menoyo" 3 => "E. del Rio" 4 => "M. Gómez-Pardo" 5 => "M. Baiget" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bjc.6602042" "Revista" => array:6 [ "tituloSerie" => "Br J Cancer" "fecha" => "2004" "volumen" => "91" "paginaInicial" => "678" "paginaFinal" => "682" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15280927" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0150" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Weekly régimen of irinotecan/docetaxel in previously treated non-small cell lung cáncer patients and correlation with uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) polymorphism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Font" 1 => "J.M. Sánchez" 2 => "M. Tarón" 3 => "E. Martinez-Ballibrea" 4 => "J.J. Sánchez" 5 => "J.L. Manzano" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Invest New Drugs" "fecha" => "2003" "volumen" => "21" "paginaInicial" => "435" "paginaFinal" => "443" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14586211" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0155" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pegvisomant-induced liver injury is related to the UGT1A1*28 polymorphism of Gilbert's syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Bernabeu" 1 => "M. Marazuela" 2 => "T. Lucas" 3 => "L. Loidi" 4 => "C. Alvarez-Escolá" 5 => "M. Luque-Ramírez" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1210/jc.2009-2547" "Revista" => array:6 [ "tituloSerie" => "J Clin Endocrinol Metab" "fecha" => "2010" "volumen" => "95" "paginaInicial" => "2147" "paginaFinal" => "2154" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20207827" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0160" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "UGT1A1 and TYMS genetic variants predict toxicity and response of colorectal cancer patients treated with first-line irinotecan and fluorouracil combination therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E. Martínez-Ballibrea" 1 => "A. Abad" 2 => "A. Martínez-Cardús" 3 => "A. Ginés" 4 => "M. Valladares" 5 => "M. Navarro" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.bjc.6605776" "Revista" => array:6 [ "tituloSerie" => "Br J Cancer" "fecha" => "2010" "volumen" => "103" "paginaInicial" => "581" "paginaFinal" => "589" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20628391" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0165" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Polymorphisms of UGT1A1*6, UGT1A1*27 & UGT1A1*28 in three major ethnic groups from Malaysia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L.K. Teh" 1 => "H. Hashim" 2 => "Z.A. Zakaria" 3 => "M.Z. Salleh" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Indian J Med Res" "fecha" => "2012" "volumen" => "136" "paginaInicial" => "249" "paginaFinal" => "259" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22960892" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0170" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular genetic basis of Gilbert's syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B. Burchell" 1 => "R. Hume" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Gastroenterol Hepatol" "fecha" => "1999" "volumen" => "14" "paginaInicial" => "960" "paginaFinal" => "966" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10530490" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack264448" "titulo" => "Acknowledgements" "texto" => "<p id="par0150" class="elsevierStylePara elsevierViewall">We would like to thank the patients diagnosed with the fasting test for their participation in the genetic study of their disease. We would also like to thank the nursing and technical staff of the Department of Clinical Analysis of the General Hospital of Valencia for their collaboration and excellent team work. Finally, we would like to thank Paula Puchalt of the Molecular Genetics Laboratory for her collaboration.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/22548874/0000021700000001/v1_201701170152/S2254887416300820/v1_201701170152/en/main.assets" "Apartado" => array:4 [ "identificador" => "1901" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/22548874/0000021700000001/v1_201701170152/S2254887416300820/v1_201701170152/en/main.pdf?idApp=WRCEE&text.app=https://revclinesp.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2254887416300820?idApp=WRCEE" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 February | 1 | 0 | 1 |
| 2023 March | 5 | 4 | 9 |
| 2017 January | 0 | 2 | 2 |
